Made a couple of test platform independent · biojava/biojava@eadd1ef · GitHub

biojava / biojava Public

• Notifications You must be signed in to change notification settings
• Fork 399
• Star 632

• Code
• Issues 68
• Pull requests
• Actions
• Security and quality
• Insights

Additional navigation options

Commit eadd1ef

Browse filesBrowse the repository at this point in the historyBrowse files

MikkelVestergaard

committed

Made a couple of test platform independent

1 parent 7be9a41 commit eadd1ef
Copy full SHA for eadd1ef

2 files changed

+10-10Lines changed: 10 additions & 10 deletions

File tree

Expand file treeCollapse file tree

Open diff view settings

Filter options

• biojava-alignment/src/test/java/org/biojava/nbio
  • alignment
    • TestSubOptimalMSA.java
  • phylo
    • TestForesterWrapper.java

Expand file treeCollapse file tree

Open diff view settings

Collapse file

‎biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java‎

Copy file name to clipboardExpand all lines: biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java

+6-6Lines changed: 6 additions & 6 deletions

Original file line number	Diff line number	Diff line change
@@ -55,9 +55,9 @@ public void gapPenalty52() {
55	55	Profile<DNASequence, NucleotideCompound> msa = Alignments
56	56	.getMultipleSequenceAlignment(sequences, gapP);
57	57
58		- assertEquals("TTGGGGCCTCTAAACGGGGTCTT\n"
59		- + "TTGGGGCCTCTAAACGGG-TCTT\n"
60		- + "TTGGGGC-TCTAA-CGGG-TCTT\n",
	58	+ assertEquals("TTGGGGCCTCTAAACGGGGTCTT" + System.lineSeparator()
	59	+ + "TTGGGGCCTCTAAACGGG-TCTT" + System.lineSeparator()
	60	+ + "TTGGGGC-TCTAA-CGGG-TCTT" + System.lineSeparator(),
61	61	msa.toString());
62	62
63	63	ConcurrencyTools.shutdown();
@@ -71,9 +71,9 @@ public void gapPenaltyDefault() {
71	71	.getMultipleSequenceAlignment(sequences, gapP);
72	72
73	73	// TODO test not passing (see issue 288 in github) - Aleix 03.2016
74		- assertEquals("TTGGGGCCTCTAAACGGGGTCTT\n"
75		- + "TTGGGGCCTCTAAACGGG-TCTT\n"
76		- + "TTGGGGC-TCTAA-CGGG-TCTT\n",
	74	+ assertEquals("TTGGGGCCTCTAAACGGGGTCTT" + System.lineSeparator()
	75	+ + "TTGGGGCCTCTAAACGGG-TCTT" + System.lineSeparator()
	76	+ + "TTGGGGC-TCTAA-CGGG-TCTT" + System.lineSeparator(),
77	77	msa.toString());
78	78
79	79	ConcurrencyTools.shutdown();

Collapse file

‎biojava-alignment/src/test/java/org/biojava/nbio/phylo/TestForesterWrapper.java‎

Copy file name to clipboardExpand all lines: biojava-alignment/src/test/java/org/biojava/nbio/phylo/TestForesterWrapper.java

+4-4Lines changed: 4 additions & 4 deletions

Original file line number	Diff line number	Diff line change
@@ -72,8 +72,8 @@ public void testMSAconversion() throws Exception {
72	72	String expected = "";
73	73	for (ProteinSequence proteinSequence : proteinSequences.values()) {
74	74	msa.addAlignedSequence(proteinSequence);
75		- expected += ">" + proteinSequence.getOriginalHeader() + "\n"
76		- + proteinSequence.toString() + "\n";
	75	+ expected += ">" + proteinSequence.getOriginalHeader() + System.lineSeparator()
	76	+ + proteinSequence.toString() + System.lineSeparator();
77	77	}
78	78
79	79	// Convert the biojava MSA to a FASTA String
@@ -95,8 +95,8 @@ public String getHeader(ProteinSequence sequence) {
95	95
96	96	StringBuilder sb = new StringBuilder();
97	97	for (int i = 0; i < fMsa.getNumberOfSequences(); i++) {
98		- sb.append(">" + fMsa.getIdentifier(i) + "\n");
99		- sb.append(fMsa.getSequenceAsString(i) + "\n");
	98	+ sb.append(">" + fMsa.getIdentifier(i) + System.lineSeparator());
	99	+ sb.append(fMsa.getSequenceAsString(i) + System.lineSeparator());
100	100	}
101	101	String forester = sb.toString();
102	102

0 commit comments

Comments

0 (0)