| FazBrowse GitHub Viewer | Trending | | Home |
| Tools: [Download Repo ZIP] [Original HTTPS Page] |
| Name | Name | Last commit date | ||
|---|---|---|---|---|
A React wrapper around the BioJS sequence-viewer component.
npm install --save react-sequence-viewer
The following are dependencies required by the sequence-viewer module that is wrapped by this React component.
You can either include these into your HTML page or add them to your own application build (see usage below).
<script src="https://ajax.googleapis.com/ajax/libs/jquery/3.1.1/jquery.min.js"></script>
<link rel="stylesheet" type="text/css" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/css/bootstrap.min.css"></link>The following code renders a sequence-viewer component in the HTML element with an ID of 'sequence-viewer1'.
ES6
import React from 'react';
import ReactDOM from 'react-dom';
// Either uncomment these lines or pull
// in jQuery and Bootstrap into the HTML page of your application.
// The below requires that jQuery/Bootstrap be installed as a dependency
// in your package.json file.
//import jquery from 'jquery';
//window.jQuery = jquery;
//import 'bootstrap/dist/css/bootstrap.min.css';
import ReactSequenceViewer from 'react-sequence-viewer';
const mySeq = 'CAGTCGATCGTAGCTAGCTAGCTGATCGATGC';
ReactDOM.render(
<ReactSequenceViewer sequence={mySeq} />,
document.getElementById('#sequence-viewer1')
);import React from 'react';
import ReactDOM from 'react-dom';
// Either uncomment these lines or pull
// in jQuery and Bootstrap into the HTML page of your application.
// The below requires that jQuery/Bootstrap be installed as a dependency
// in your package.json file.
//import jquery from 'jquery';
//window.jQuery = jquery;
//import 'bootstrap/dist/css/bootstrap.min.css';
import ReactSequenceViewer from 'react-sequence-viewer';
const mySeq = 'CAGTCGATCGTAGCTAGCTAGCTGATCGATGC';
const options = {
badge: true,
search: false,
showLineNumbers: true,
title: "my sequence",
toolbar: false,
};
ReactDOM.render(
<ReactSequenceViewer sequence={mySeq} {...options} />,
document.getElementById('#sequence-viewer1')
);Please see the Sequence Viewer documentation for more details on the options below.
| Name | Description | Type | Required | Comment |
|---|---|---|---|---|
| className | HTML class name to apply to the Sequence Viewer div container | String | No | |
| coverage | Advanced sequence hightlighting | Array[Objects] | No | Not compatible with selection |
| id | The ID to use for the Sequence Viewer container element | String | No | |
| legend | Adds a legend to the sequence | Array[Objects] | No | |
| onMouseSelection | Event handler for sequence selection with the mouse | function | No | |
| onSubpartSelected | Event handler for sequence selected via the search box | function | No | |
| selection | A region to highlight | Array | No | Not compatible with coverage |
| sequence | The sequence to render. | String | Yes |
| Back | FazBrowse Home | New Git URL |